Python：如果…否则为False语句（布尔值），则返回True

Question

Transitions between A <-> G and C <-> T
Transversions between A <-> C and G <-> T

Assignment:

• Write a function transition that takes two nucleotides. The function must return a Boolean value that indicates whether or not replacing the first nucleotide by the second nucleotide leads to a transition.

Problem: I don't think the function recognizes the statement behind the or . The code doesn't work in some cases for example: transition('A', 'G') is True and with my code he gives False

• Write a function ratio that takes two DNA sequences s1 and s2
  The function may assume that both sequences have the same length (the function does not need to check this explicitly). The function must return the transition/transversion ratio R(s 1 ,s 2 )∈R of the two given sequences as a floating point number. In case there are no transversions between the two sequences, R(s 1 ,s 2 )=0 by definition.

Problem: the code is not working

def transition(letter1, letter2):        
    """
    >>> transition('G', 'A')
    True
    >>> transition('t', 'g')
    False
    >>> transition('C', 'c')
    False
    """    
    return True if letter1.lower() == 'gt' and letter2.lower() == 'ac' or letter1.lower() == 'ac' and letter2.lower() == 'gt' else False


def transversion(letter1, letter2):
    """
    >>> transversion('G', 'A')
    False
    >>> transversion('t', 'g')
    True
    >>> transversion('C', 'c')
    False
    """
    return True if letter1.lower() == 'ct' and letter2.lower() == 'ag' or  letter1.lower() == 'ag' and letter2.lower() == 'ct' else False


def ratio(seq1, seq2):
    """
    >>> ratio('ATTAGCATTATCATC', 'AAATAGGATATATGG')
    0.2222222222222222
    >>> seq1 = 'GCAACGCACAACGAAAACCCTTAGGGACTGGATTATTTCGTGATCGTTGTAGTTATTGGAAGTACGGGCATCAACCCAGTT'
    >>> seq2 = 'ttatctgacaaagaaagccgtcaacggctggataatttcgcgatcgtgctggttactggcggtacgagtgttcctttgggt'
    >>> ratio(seq1, seq2)   
    1.2142857142857142
    """
    count = 0
    tel = 0

    for i in range(len(seq1)):
        if transition(seq1[i], seq2[i]):
            count += 1

    for i in range(len(seq1)):
        if transversion(seq1[i], seq2[i]):
            tel += 1

    if tel != 0:
        return float(count / tel)
    else:
        return 0 

if __name__ == '__main__':
    import doctest
    doctest.testmod()

Answer 1

Change the lines like this

return True if letter1.lower() == 'gt' and letter2.lower() == 'ac' or letter1.lower() == 'ac' and letter2.lower() == 'gt' else False

by :

return (letter1.lower() == 'gt' and letter2.lower() == 'ac' or letter1.lower() == 'ac' and letter2.lower() == 'gt') 

Answer 2

I think transition or transversion of same nucleobase must return False
( ie transition('A','A') ==False )

You can simplify using simple naming predicat : https://repl.it/N4TC/4

def transition(nucleobase1, nucleobase2):        
   """ True if both are different and are purine
   """
   return (not isEqual(nucleobase1, nucleobase2) and
           isPurine(nucleobase1) and 
           isPurine(nucleobase2))

def transversion(nucleobase1, nucleobase2):        
   """ True if both are different and not transition
   """
   return (not isEqual(nucleobase1, nucleobase2) and
           not transition(nucleobase1, nucleobase2))

Other predicat :

### nucleobase Predicat    

def isAdenine(nucleobase):
    """ True if adenine (A)
    """
    return nucleobase.lower()=='a'

def isCytosine(nucleobase):
    """ True if cytosine (C)
    """
    return nucleobase.lower()=='c'

def isGuanine(nucleobase):
    """ True if guanine (G)
    """
    return nucleobase.lower()=='g'

def isThymine(nucleobase):
    """ True if thymine (T)    
    """
    return nucleobase.lower()=='t'

def isPurine(nucleobase):
    """ True if adenine (A) or guanine (G)
    """
    return isAdenine(nucleobase) or isGuanine(nucleobase)

def isPyrimidine(nucleobase):
    """ True if cytosine (C) or thymine (T)
    """
    return isCytosine(nucleobase) or isThymine(nucleobase)

def isEqual(nucleobase1, nucleobase2):
    """ Equal ignore case
    """
    return nucleobase1.lower()==nucleobase2.lower()      

Answer 3

As a general rule of thumb you can if you have multiple conditions assign them to variables first. Might not be the answer you were looking for but possibly can help you write easier-to-read code.

Like this:

letter1 = "GT"
letter2 = "AC"

def transition(letter1, letter2):

    cond1 = (letter1.lower() == 'gt')
    cond2 = (letter2.lower() == 'ac')
    cond3 = (letter1.lower() == 'ac')
    cond4 = (letter2.lower() == 'gt')

    if (cond1 and cond2) or (cond3 and cond4):
        return True
    else:
        return False

transition(letter1,letter2)

Answer 4

Try this:

def transition(letter1, letter2):        
   """
   >>> transition('G', 'A')
   True
   >>> transition('t', 'g')
   False
   >>> transition('C', 'c')
   False
   """
   if letter1.lower() == letter2.lower():
       return False

   return (letter1.lower() in 'ag' and letter2.lower() in 'ag') or (letter1.lower() in 'ct' and letter2.lower() in 'ct')

and

def transversion(letter1, letter2):        
   """
   >>> transversion('G', 'A')
   False
   >>> transition('t', 'g')
   True
   >>> transition('C', 'c')
   False
   """
   if letter1.lower() == letter2.lower():
       return False

   return (letter1.lower() in 'ac' and letter2.lower() in 'ac') or (letter1.lower() in 'gt' and letter2.lower() in 'gt')

It seems with letter1.lower() == 'gt' you are trying to check if the letter is either g or t. You do that with in instead of == .