嵌套字典 python 语法

Question

Running into some syntax problems trying to generate a nested dictionary. My code attempt is the following:

from collections import defaultdict

count = 0
target_dict = defaultdict(dict)
for alignment in item.alignments:
          for hsp in alignment.hsps:
                 if hsp.expect < E_VALUE_THRESH:
                    try:
                        target_dict['Entry'+'_'+str(count)]['Sequence'+'_'+str(count)] = alignment.title,/
                                                           ['Length'+('_'+str(count))] = alignment.length,/
                                                           ['Score'+('_'+str(count))] == hsp.score/
                                                           ['Hsp_query'+('_'+str(count))] == ("{}".format(hsp.query[0:90]))/
                                                           ['Hsp_match'+('_'+str(count))] == ("{}".format(hsp.match[0:90]))/
                                                           ['Hsp_sbjct'+('_'+str(count))] == ("{}".format(hsp.sbjct[0:90]))



                    except KeyError as e:
                        print('exception missing key', e)
                    count+=1

Gives kindof what I'm looking for (but when trying to add additional key:value pairs inside the entry key I get syntax errors:

 target_dict['Entry'+'_'+str(count)]['Sequence'+'_'+str(count)] = alignment.title,/
                                                                                     ^
SyntaxError: invalid syntax

Desired output is:

{'Entry_0': {'Sequence_0': 'gi|1219041180|ref|XM_021875076.1| PREDICTED: Chenopodium quinoa cold-regulated 413 plasma membrane, 
 'Length_0': 1173,
 'Score_0': 482.0,
 'Hsp_query_0': 'ACAGAAAATGGGGAGAGAAATGAAGTACTTGGCCATGAAAACTGATCAATTGGCCGTGGCTAATATGATCGATTCCGATATCAATGAGCT',
 'Hsp_match_0': '|| ||||||||| |||| | |||| ||  |||| |||| | |||| ||| | |||| ||| ||| ||||| | ||||| |||||||||||',
 'Hsp_sbjct_0': 'ACCGAAAATGGGCAGAGGAGTGAATTATATGGCAATGACACCTGAGCAACTAGCCGCGGCCAATTTGATCAACTCCGACATCAATGAGCT',

How can I make this nested dictionary? Any help on how I'm going wrong with syntax would be much appreciated thank you!

Answer 1

I think you are trying to "add to the [inner] dictionary" incorrectly. This is a toy example:

from collections import defaultdict

# fake data
titles = ['dog', 'cat']
colors = ['brown', 'yellow']
weight = [20, 2]

entries = defaultdict(dict)

for idx, title in enumerate(titles):
    # make the new inner dictionary with one key:value pair, color
    entries[title]['color'] = colors[idx]

    # add to inner dictionary with second key:value pair
    entries[title]['weight'] = weight[idx]

print(entries['cat'])

However, I'm not sure why you are using a nested dictionary when the keys to your outer dictionary are just Entry_0 and Entry_1 .... Why don't you just make a list of dictionaries with the schema that the list index is the entry number? You could then create dictionaries and append them to the list easily.