如何在不使用 range() python 的情况下删除文本文档的特定部分

Question

Basically, I am given a text document that contains a header (about 8 lines) and then a bunch of lines of DNA sequence. I can figure out all of the solution I need to solve my particular issue except how to extract the DNA sequences from the header. I was able to put everything in a list using

dna = open("dna_sequence.txt").read().split('\n')

that was able to successfully take every individual line and put them all in a list. which is what i want. however the first 8 items in the list are garbage essentially and i need to remove them from the rest of the list without using like .pop() or slice or creating the list from a range.

the only module we are allowed to use for this assignment is pandas, but we havent gone over it that much yet, and i am not familiar with it. I know it can be done without that module.

Okay, so from the comments here is more information, sorry I didnt include it, didnt know it would be important :D

LOCUS: SCU49845
ACCESSION: U49845
ORGANISM: Saccharomyces cerevisiae (baker's yeast)          
AUTHORS: Roemer,T., Madden,K., Chang,J. and Snyder,M.
TITLE: Selection of axial growth sites in yeast requires Axl2p, a novel plasma membrane glycoprotein
JOURNAL: Genes Dev. 10 (7), 777-793 (1996)
PUBMED: 8846915
SOURCE: https://www.ncbi.nlm.nih.gov/nuccore/U49845.1?report=genbank&to=5028
GATCCTCCATATACAACGGTATCTCCACCTCAGGTTTAGATCTCAACAACGGAACCATTGCCGACATGAG
ACAGTTAGGTATCGTCGAGAGTTACAAGCTAAAACGAGCAGTAGTCAGCTCTGCATCTGAAGCCGCTGAA
GTTCTACTAAGGGTGGATAACATCATCCGTGCAAGACCAAGAACCGCCAATAGACAACATATGTAACATA
TTTAGGATATACCTCGAAAATAATAAACCGCCACACTGTCATTATTATAATTAGAAACAGAACGCAAAAA

So the .txt document I am going to be using looks like this. with a bunch for lines of code. I need to remove the parts above the DNA sequence so I am left with a list of just the DNA sequences, doesnt really matter how long the strings are since i will just use a for loop for the next part of the assignment.

The assignment is to take the DNA sequences and create a single string that contains the complements. Which i can easily do with a for loop since there are only 4 nucleotides and they each only have 1 complement.

He specifically said we can do it with pandas, but since we havent gone over it much he doesnt expect us to know exactly how to do it, and we can do it with just python.

if i could just do dna.slice(1,9) that would be simple, but he said we cannot do that. so i am lost

Answer 1

If you are just looking to get the dna sequence, you could use a regex to go through the file:

import re

with open(somefile) as fh:
     mydna = [line for line in fh if re.match('^[AGCT]+$', line)]

mydna
# ['GATCCTCCATATACAACGGTATCTCCACCTCAGGTTTAGATCTCAACAACGGAACCATTGCCGACATGAG',
# 'ACAGTTAGGTATCGTCGAGAGTTACAAGCTAAAACGAGCAGTAGTCAGCTCTGCATCTGAAGCCGCTGAA',
# 'GTTCTACTAAGGGTGGATAACATCATCCGTGCAAGACCAAGAACCGCCAATAGACAACATATGTAACATA',
# 'TTTAGGATATACCTCGAAAATAATAAACCGCCACACTGTCATTATTATAATTAGAAACAGAACGCAAAAA']

That way you aren't ignoring an arbitrary amount of lines, though this isn't a pandas-specific answer.

To build the complement dna strings, you could use a dictionary to map bases to their complements and iterate over each string like so:

mapping = {'A': 'T', 'T': 'A', 'C': 'G', 'G':'C'}

# .get(base, ' ') will either return the value or an empty string
# mapping.get('A', ' ') will return 'T' whereas mapping.get('U', ' ') will 
# return ' '
complements = [''.join(mapping.get(base, ' ') for base in dna) for dna in mydna]

Answer 2

Pandas answer:

import pandas as pd

df = pd.read_csv(sep="\n", header=None, names = ['code'])

regex = "[^ATCG]+\\b"     # Regex that gets eveything that's not a DNA code.
filter = df['code'].str.contains(regex)
df = df[~filter]          # Keep only the DNA codes.

Answer 3

Okay, just to clarify, and show the answer that i got, just in case someone else has this same question.

I was allowed to use re, i checked with my professor.

but the assignment was, "Define a function, so that, provided an input from a text file (*.txt) would find all DNA sequences and provide the complements"

thanks to you guys, and some youtubing/reading this is what i came up with: (i am 100% positive it can probably be cleaned up, but its not due til monday)

import re
def dnaMatching(t):
    with open(t) as n:
        dna = [line for line in m if re.match(r'^[AGCT]+$', line)]
    complement = ""
    for i in dna:
        for x in i:
            if x == 'A':
                complement += 'T'
            elif x == 'G':
                complement += 'C'
            elif x == 'C':
                complement += 'G'
            elif x == 'T':
                complement += 'A'
    return complement

thank you guys so much for your help!