Move lines in file using awk/sed

Question

Hi my files look like:

>ID.1
GGAACACGACATCCTGCAGGGTTAAAAAAGAAAAAATCAGTAAAAGTACTGGA
>ID.2
GGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGA

and I want to move the lines so that line 1 swaps with 3, and line 2 swaps with 4.

>ID.2
GGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGA
>ID.1
GGAACACGACATCCTGCAGGGTTAAAAAAGAAAAAATCAGTAAAAGTACTGGA

I have thought about using cut so cut send the lines into other files, and then bring them all back in the desired order using paste , but is there a solution using awk/sed.

EDIT: The file always has 4 lines (2 fasta entrys), no more.

Answer 1

For such a simple case, as @Ed_Morton mentioned, you can just swap the even-sized slices with head and tail commands:

$ tail -2 test.txt; head -2 test.txt

---

>ID.2
GGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGA
>ID.1
GGAACACGACATCCTGCAGGGTTAAAAAAGAAAAAATCAGTAAAAGTACTGGA

Answer 2

Generic solution with GNU tac to reverse contents:

$ tac -bs'>' ip.txt
>ID.2
GGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGA
>ID.1
GGAACACGACATCCTGCAGGGTTAAAAAAGAAAAAATCAGTAAAAGTACTGGA

By default tac reverses line wise but you can customize the separator.

Here, I'm assuming > can be safely used as a unique separator (provided to the -s option). The -b option is used to put the separator before the content in the output.

---

Using ed (inplace editing):

# move 3rd to 4th lines to the top
printf '3,4m0\nwq\n' | ed -s ip.txt

# move the last two lines to the top
printf -- '-1,$m0\nwq\n' | ed -s ip.txt

Answer 3

Using sed:

sed '1h;2H;1,2d;4G'

• Store the first line in the hold space;
• Add the second line to the hold space;
• Don't print the first two lines;
• Before printing the fourth line, append the hold space to it (ie append the 1st and 2nd line).

Answer 4

GNU AWK manual has example of swapping two lines using getline as you know that

The file always has 4 lines (2 fasta entrys), no more.

then you might care only about case when number of lines is evenly divisble by 4 and use getline following way, let file.txt content be

>ID.1
GGAACACGACATCCTGCAGGGTTAAAAAAGAAAAAATCAGTAAAAGTACTGGA
>ID.2
GGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGA

then

awk '{line1=$0;getline line2;getline line3;getline line4;printf "%s\n%s\n%s\n%s\n",line3,line4,line1,line2}' file.txt

gives output

>ID.2
GGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGA
>ID.1
GGAACACGACATCCTGCAGGGTTAAAAAAGAAAAAATCAGTAAAAGTACTGGA

Explanation: store current line in variable $0 , then next line as line2 , yet next line as line3 , yet next line as line4 , use printf with 4 placeholders ( %s ) followed by newlines ( \n ), which are filled accordingly to your requirement.

(tested in GNU Awk 5.0.1)

Answer 5

GNU sed:

sed -zE 's/(.*\r?\n)(.*\r?\n?)/\2\1/' file 

A Perl:

perl -0777 -pe 's/(.*\R.*\R)(.*\R.*\R?)/\2\1/' file

A ruby:

ruby -ne 'BEGIN{lines=[]}
lines<<$_
END{puts lines[2...4]+lines[0...2] }' file 

Paste and awk:

paste -s file | awk -F'\t' '{print $3, $4, $1, $2}' OFS='\n'

A POSIX pipe:

paste -sd'\t\n' file | nl | sort -nr | cut -f 2- | tr '\t' '\n'

Answer 6

This seems to work:

awk -F'\n' '{print $3, $4, $1, $2}' OFS='\n' RS= ORS='\n\n' file.txt