The goal of this project is to open and read a DNA sequences from a text file, eg if the sub-string is AGATC and then the consecutive sub-string is also, we add to the counter, once the consecutive sub-string is no longer AGATC the aim is to tally it to the highest score in the range, clear the counter and continue searching so as to find the longest consecutive sequence.
str_count = []
counter = 0
highest = 0
# read sequence
with open(argv[2], "r") as seq:
seqRead = seq.read()
for i in range(len(seqRead)):
#search for consecutive AGATC
if i == 'A' and seqRead[i:i+6] == 'AGATC':
while i == 'A' and seqRead[i:i+6] == 'AGATC':
counter += 1
i = i + 5
if highest < counter:
highest = counter
counter = 0
else:
counter = 0
Right now the problem I think i am having is I don't think I am comparing the text sequence correctly and thus not reading the correct sequence of letters in the string.
My aim is to track 'i' as a 'A' and then extract sequential 4 letters and compare it to 'AGATC' and then if it matches increase the counter and change 'i' to the letter following the compared, and if it is A repeating until no longer consecutively, and then adding to highest until reaching the end. This is the im atleast, however when running the debugger I notice that it never enters the first if statement, which leads me to believe the way I am comparing is incorrect.
Sample input:
AGATCAGATCAGATCAGATCAGATCDJFDHFDTTTTCCSSDDSDDGFJFHAGATCAGATCAGATCAGATCAGATCAGATGJFHJGHJDSHGDKFSAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCDKFDKDFKGJKDFKAGATCkFGJKFDDAGATCDFKJKFJFKDJKAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCKFDHDFKFDHKGHKDFGJFKHDFK
Expected output: highest = 30
Due to the fact that the longest consecutive appearance of AGATC is 30.
input:
AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG
output: highest = 4
Am i mistaken with how to use the seqRead[i:i+6]?
And how could I go about doing this better?
Your substring is too long, seqRead[i:i+6]
will give a string of length 6 characters, rather than 5. That line (and the other line which makes a similar comparison) should be seqRead[i:i+5]
instead. Also, you were trying to compare your iterator ( i
) to a letter, when I think you meant to compare the letter at the position of the iterator in seqRead
instead. i == 'A'
should be changed to seqRead[i] == 'A'
:
str_count = []
counter = 0
highest = 0
# read sequence
with open(argv[2], "r") as seq:
seqRead = seq.read()
for i in range(len(seqRead)):
#search for consecutive AGATC
if seqRead[i] == 'A' and seqRead[i:i+5] == 'AGATC':
while seqRead[i] == 'A' and seqRead[i:i+5] == 'AGATC':
counter += 1
i = i + 5
if highest < counter:
highest = counter
counter = 0
else:
counter = 0
In your code if
before while
loop is redundant. And you're slicing an incorrect substring, here is the updated and simplified code:
for i in range(len(seqRead)):
while seqRead[i:i+5] == "AGATC":
counter += 1
i += 5
if counter > highest:
highest = counter
counter = 0
The technical post webpages of this site follow the CC BY-SA 4.0 protocol. If you need to reprint, please indicate the site URL or the original address.Any question please contact:yoyou2525@163.com.