Count the number of occurences of letters in a Python string
Question
So I got a DNA sequence.
ACCAGAGCGGCACAGCAGCGACATCAGCACTAGCACTAGCATCAGCATCAGCATCAGC
CTACATCATCACAGCAGCATCAGCATCGACATCAGCATCAGCATCAGCATCGACGACT
ACACCCCCCCCGGTGTGTGTGGGGGGTTAAAAATGATGAGTGATGAGTGAGTTGTGTG
CTACATCATCACAGCAGCATCAGCATCGACATCAGCATCAGCATCAGCATCGACGACT
TTCTATCATCATTCGGCGGGGGGATATATTATAGCGCGCGATTATTGCGCAGTCTACG
TCATCGACTACGATCAGCATCAGCATCAGCATCAGCATCGACTAGCATCAGCTACGAC
I need to count the bases.
Also for some reason it can sometimes it can alternate between upper or lowercase in the same string.
1 answers
solution1
7 ACCPTED 2009-11-15 19:00:05
for base in 'ACGT':
print base, thesequence.count(base) + thesequence.count(base.lower())
The technical post webpages of this site follow the CC BY-SA 4.0 protocol. If you need to reprint, please indicate the site URL or the original address.Any question please contact:yoyou2525@163.com.
Related Question
Python count occurences of a string and print the lines that contain them, as well as print number of occurences of string, with multiple clauses
Python: count string and output letters that match a number
Count the number of occurences of a pattern in a list in Python
Python dataframes count number of occurences in two columns
Count number of letters in string (not characters, only letters)
Python - how to count number of uppercase letters in a string that is in a list
pythonic way to count total number of letters in string in python
Python count the number of occurrences and also the elements with maximum occurences separately after splitting the string in list from dictionary
Count multiple letters in string Python
Python:Count occurrences of letters in a string
Related Tags