I am trying to find strings which are at most two mistakes 'away' from the original pattern string (ie they differ by at most two letters).
However, the following code isn't working as I would expect, at least not from my understanding of fuzzy regex:
import regex
res = regex.findall("(ATAGGAGAAGATGATGTATA){e<=2}", "ATAGAGCAAGATGATGTATA", overlapped=True)
print res
>> ['ATAGAGCAAGATGATGTATA'] # the second string
As you can see, the two strings differ on three letters rather than at most two:
the first has: ATAG GAG AAGATGATGTATA
the second has: ATAG AGC AAGATGATGTATA
and yet the result shows the second string, as though it's within e<=2 (this also happens with overlapped=False, so that can't be it).
What am I missing here? And is there any way of getting this to find only strings within the Hamming 2-ball of the given pattern?
Is it possible that a swap of letters is considered to be only one change? And if so - how can I avoid this?
Let's check this snippet for fuzzy counts:
>>> pattern_string = 'ATAGGAGAAGATGATGTATA'
>>> query_string = 'ATAGAGCAAGATGATGTATA'
>>> r = regex.compile('(%s){e<=2}' % pattern_string)
>>> r.match(query_string)
<regex.Match object; span=(0, 20), match='ATAGAGCAAGATGATGTATA', fuzzy_counts=(0, 1, 1)>
fuzzy_counts=(0, 1, 1)
means that in this case, we get no substitutions, 1 insertion, and 1 deletion. So your filter works because the total count of errors is 2.
But it seems that you need to filter only by substitutions count, so you can modify the regex:
import regex
res = regex.findall("(ATAGGAGAAGATGATGTATA){s<=2}", "ATAGAGCAAGATGATGTATA", overlapped=True)
print res
Check this great example from docs :
{1<=e<=3} permit at least 1 and at most 3 errors
{i<=2,d<=2,e<=3} permit at most 2 insertions, at most 2 deletions, at most 3 errors in total, but no substitutions
Your mistake is to assume that "errors" are the same thing as "substitutions", when this is not the case.
The regex
package's fuzzy matching understands three kinds of errors - insertions, deletions, and substitutions. An error distance specified with e
, as you've used, can be made up of any combination of those errors. And ATAGGAGAAGATGATGTATA
can be edited into ATAGAGCAAGATGATGTATA
with only two such operations (1 deletion and 1 insertion), as shown by the sequence alignment below:
ATAGGAG-AAGATGATGTATA
ATAG-AGCAAGATGATGTATA
is there any way of getting this to find only strings within the Hamming 2-ball of the given pattern?
Yes. Note that Hamming distance is a kind of edit distance that measures the minimum number of substitutions required to edit one string to another of equal length. So to only match strings within the Hamming 2-ball of pattern, we need to tell regex
to match anything within 2 substitutions , which we can do by using the s
error type instead of e
:
import regex
res = regex.findall("(ATAGGAGAAGATGATGTATA){s<=2}", "ATAGAGCAAGATGATGTATA", overlapped=True)
print res
Is it possible that a swap of letters is considered to be only one change?
Not in the regex
package as it currently stands. The standard term of art for a "swap" of two characters is a "transposition". Edit distances that include transpositions as a possible edit (eg Dameau-Levenshtein distance , in which edits can be insertions, substitutions, deletions, or transpositions of adjacent characters) do exist and are useful for some applications (eg typo correction). However, at the time of writing, the fuzzy matching in the regex
package does not have any support for them at all.
The technical post webpages of this site follow the CC BY-SA 4.0 protocol. If you need to reprint, please indicate the site URL or the original address.Any question please contact:yoyou2525@163.com.